Proceedings of the 2019 Ahmad Dahlan International Conference Series on Pharmacy and Health Science (ADICS-PHS 2019)

Porcine-specific Primer based on Cytochrome B by Real-Time Polymerase Chain Reaction Method for Identification in Raw Meat

Authors
Nina Salamah, Yuny Erwanto, Sudibyo Martono, Abdul Rohman
Corresponding Author
Nina Salamah
Available Online November 2019.
DOI
10.2991/adics-phs-19.2019.29How to use a DOI?
Keywords
real-time polymerase chain reaction, cytochrome-b, pork (sus scrofa), halal authentication
Abstract

Pork is a type of meat that is often used for counterfeiting products with a composition of beef. This counterfeiting can provide large profits to producers, given the price of pork is far below the price of beef. So we need specific methods to ensure the halal product. The purpose of this study was to obtain a method for identification of pork using real-time PCR instruments. The validation parameters of the PCR real-time method include sensitivity test, linearity test, determination of detection limit and repeatability test. Specific pig primers designed with the NCBI and Primer-BLAST software (5 '- CGGAACAGACCTCGTAGAATG - 3' (forward) and 5 '- GGTAATGATGAATGGCAGGATAAAG - 3' (reverse) can amplify pig mitochondrial DNA Cytochrome with annealing temperature of 53.20C. Primary specificity is shown by Melting Curve Analysis (MCA) characterized by the appearance of a peak at the melting peak. Specificity testing was done on 4 DNA isolates of fresh meat (pork, chicken, beef, dog) and negative control. The results of the sensitivity test on fresh meat produced an efficiency value (E) of 417.4% and an R-value of 0.908. In the repeatability test, the Coefficient Variation (CV) value of fresh dog meat DNA isolates concentration of 50 ng / µL was 0.57%.

Copyright
© 2019, the Authors. Published by Atlantis Press.
Open Access
This is an open access article distributed under the CC BY-NC license (http://creativecommons.org/licenses/by-nc/4.0/).

Download article (PDF)

Volume Title
Proceedings of the 2019 Ahmad Dahlan International Conference Series on Pharmacy and Health Science (ADICS-PHS 2019)
Series
Advances in Health Sciences Research
Publication Date
November 2019
ISBN
10.2991/adics-phs-19.2019.29
ISSN
2468-5739
DOI
10.2991/adics-phs-19.2019.29How to use a DOI?
Copyright
© 2019, the Authors. Published by Atlantis Press.
Open Access
This is an open access article distributed under the CC BY-NC license (http://creativecommons.org/licenses/by-nc/4.0/).

Cite this article

TY  - CONF
AU  - Nina Salamah
AU  - Yuny Erwanto
AU  - Sudibyo Martono
AU  - Abdul Rohman
PY  - 2019/11
DA  - 2019/11
TI  - Porcine-specific Primer based on Cytochrome B by Real-Time Polymerase Chain Reaction Method for Identification in Raw Meat
BT  - Proceedings of the 2019 Ahmad Dahlan International Conference Series on Pharmacy and Health Science (ADICS-PHS 2019)
PB  - Atlantis Press
SP  - 4
EP  - 8
SN  - 2468-5739
UR  - https://doi.org/10.2991/adics-phs-19.2019.29
DO  - 10.2991/adics-phs-19.2019.29
ID  - Salamah2019/11
ER  -